Based on the sequence what is the likely biological agent responsible for the epidemic?

A. An epidemic in China occurs and the following nucleotide sequence was isolated from a Show more Question 1 A. An epidemic in China occurs and the following nucleotide sequence was isolated from a patient sample: ATGAACACTCAAATCCTGGTATTCGCTCTGATTGCGATCATTCCAACAAATGCAGACAAAATCTGCCTCG GACATCATGCCGTGTCAAACGGAACCAAAGTAAACACATTAACTGAAAGAGGAGTGGAAGTCGTCAATGC AACTGAAACAGTGGAACGAACAAACATCCCCAGGATCTGCTCAAAAGGGAAAAGGACAGTTGACCTCGGT CAATGTGGACTCCTGGGGACAATCACTGGACCACCTCAATGTGACCAATTCCTAGAATTTTCAGCCGATT TAATTATTGAGAGGCGAGAAGGAAGTGATGTCTGTTATCCTGGGAAATTCGTGAATGAAGAAGCTCTGAG GCAAATTCTCAGAGAATCAGGCGGAATTGACAAGGAAGCAATGGGATTCACATACAGTGGAATAAGAACT AATGGAGCAACCAGTGCATGTAGGAGATCAGGATCTTCATTCTATGCAGAAATGAAATGGCTCCTGTCAA ACACAGATAATGCTGCATTCCCGCAGATGACTAAGTCATATAAAAATACAAGAAAAAGCCCAGCTCTAAT AGTATGGGGGATCCATCATTCCGTATCAACTGCAGAGCAAACCAAGCTATATGGGAGTGGAAACAAACTG GTGACAGTTGGGAGTTCTAATTATCAACAATCTTTTGTACCGAGTCCAGGAGCGAGACCACAAGTTAATG GTATATCTGGAAGAATTGACTTTCATTGGCTAATGCTAAATCCCAATGATACAGTCACTTTCAGTTTCAA TGGGGCTTTCATAGCTCCAGACCGTGCAAGCTTCCTGAGAGGAAAATCTATGGGAATCCAGAGTGGAGTA CAGGTTGATGCCAATTGTGAAGGGGACTGCTATCATAGTGGAGGGACAATAATAAGTAACTTGCCATTTC AGAACATAGATAGCAGGGCAGTTGGAAAATGTCCGAGATATGTTAAGCAAAGGAGTCTGCTGCTAGCAAC AGGGATGAAGAATGTTCCTGAGATTCCAAAGGGAAGAGGCCTATTTGGTGCTATAGCGGGTTTCATTGAA AATGGATGGGAAGGCCTAATTGATGGTTGGTATGGTTTCAGACACCAGAATGCACAGGGAGAGGGAACTG CTGCAGATTACAAAAGCACTCAATCGGCAATTGATCAAATAACAGGAAAATTAAACCGGCTTATAGAAAA AACCAACCAACAATTTGAGTTGATCGACAATGAATTCAATGAGGTAGAGAAGCAAATCGGTAATGTGATA AATTGGACCAGAGATTCTATAACAGAAGTGTGGTCATACAATGCTGAACTCTTGGTAGCAATGGAGAACC AGCATACAATTGATCTGGCTGATTCAGAAATGGACAAACTGTACGAACGAGTGAAAAGACAGCTGAGAGA GAATGCTGAAGAAGATGGCACTGGTTGCTTTGAAATATTTCACAAGTGTGATGATGACTGTATGGCCAGT ATTAGAAATAACACCTATGATCACAGCAAATACAGGGAAGAGGCAATGCAAAATAGAATACAGATTGACC CAGTCAAACTAAGCAGCGGCTACAAAGATGTGATACTTTGGTTTAGCTTCGGGGCATCATGTTTCATACT TCTAGCCATTGTAATGGGCCTTGTCTTCATATGTGTAAAGAATGGAAACATGCGGTGCACTATTTGTATA TAA Based on the sequence what is the likely biological agent responsible for the epidemic? Use BLAST against the default nucleotide database nr and the blastn program selection to identify a likely source of the sequence. Explain how you arrived at your answer for the virus. B. Identify the likely protein encoded by this sequence. C. For further study the protein sequence is needed. List the Protein database sequence entry in FASTA format that best correlates with the nucleotide sequence. Show less

QUICK QUOTE

Approximately 250 words